BBa_K105002 1 BBa_K105002 TUP1 - repressor domain for transcription factors in yeast 2008-10-11T11:00:00Z 2015-05-08T01:08:52Z Yeast genomic DNA. This BioBrick is the N-terminal repression domain of the yeast general repressor TUP1.<br\n> In artificial systems TUP1 is used in fusion with a DNA-binding domain. This DNA-binding domain is specific for a bait sequence. So the selective repressionn of genes with a promoter containing this bait sequence can be achieved. false false _253_ 0 3313 9 It's complicated true To enable the fusion with other domains in frame the vector of this BioBrick has no base pair in between the restriction side and the BioBrick.<br\n> For more information about this issus, see Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." - DSpace http://hdl.handle.net/1721.1/32535 (2006). true Sandra Dittmann BBa_K105002_sequence 1 actgccagcgtttcgaatacgcagaataagctgaatgagcttctcgatgccatcagacaggagtttctccaagtctcacaagaggcaaatacctaccgtcttcaaaaccaaaaggattacgatttcaaaatgaaccagcagctggctgagatgcagcagataagaaacaccgtctacgaactggaactaactcacaggaaaatgaaggacgcgtacgaagaagagatcaagcacttgaaactagggctggagcaaagagaccatcaaattgcatctttgaccgtccagcaacagcggcaacagcaacagcagcaacaggtccagcagcatttacaacagcaacagcagcagctagccgctgcatctgcatctgttccagttgcgcaacaaccaccggctactacttcggccaccgccactccagcagcaaacacaactactggttcgccatcggccttcccagtacaagctagccgtcctaatctggttggctcacagttgcctaccaccactttgcctgtggtgtcctcaaacgcccaacaacaactaccacaacagcaactgcaacagcagcaacttcaacaacagcaaccacctccccaggtttccgtggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z