BBa_K105003 1 BBa_K105003 tetR - DNA binding domain 2008-10-11T11:00:00Z 2015-05-08T01:08:52Z We changed the format of the TetR coding part of BBa_C0040 into Phillips/Silver standard. The TetR protein is a repressor that binds to a specific operator site ([[BBa_R0040]] & [[BBa_K105020]]). This site specific binding can be inhibited by the small molecule tetracyclin and analogs of tetracyclin. false false _253_ 0 3313 9 It's complicated true To enable the fusion with other domains in frame the vector of this BioBrick has no base pair in between the restriction side and the BioBrick. Furthermore, this coding sequence does not include a start codon.<br\n> The frist codon has been changed from TCC to AGT (both Ser) to prevent a methylation site. For more information about this issus, see:<br\n> Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." <br\n> DSpace http://hdl.handle.net/1721.1/32535 (2006). true Katja Karstens BBa_K105003_sequence 1 agtagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z