BBa_K105007 1 BBa_K105007 Gal4 - DNA binding domain 2008-10-11T11:00:00Z 2015-05-08T01:08:52Z lab plasmid Gal4 is a yeast transcription factor which activates the transcription.<br\n> This BioBrick is the DNA binding domain of Gal4, which binds specificly to the regulatory sequence [[Part:BBa_K105024| BBa_K105024]]. false false _253_ 0 3313 9 In stock true To enable the fusion with other domains in frame the vector of this BioBrick has no base pair in between the restriction side and the BioBrick. Furthermore, this coding sequence does not include a start codon.<br\n> For more information about this issus, see:<br\n> Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." <br\n> DSpace http://hdl.handle.net/1721.1/32535 (2006). true Katja Karstens BBa_K105007_sequence 1 aagctactgtcttctatcgaacaagcatgcgatatttgccgacttaaaaagctcaagtgctccaaagaaaaaccgaagtgcgccaagtgtctgaagaacaactgggagtgtcgctactctcccaaaaccaaaaggtctccgctgactagggcacatctgacagaagtggaatcaaggctagaaagactggaacagctatttctactgatttttcctcgagaagaccttgacatgattttgaaaatggattctttacaggatataaaagcattgttaacaggattatttgtacaagataatgtgaataaagatgccgtcacagatagattggcttcagtggagactgatatgcctctaacattgagacagcatagaataagtgcgacatcatcatcggaagagagtagtaacaaaggtcaaagacagttgactgtatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z