BBa_K105012 1 BBa_K105012 10 aa flexible protein domain linker 2008-10-18T11:00:00Z 2015-05-08T01:08:52Z Oligos with a yeast optimized coding for the peptide GENLYFQSGG have been ordered <br\n> The amino acide sequence corresponds to the interdomaine linker of xxx. ''paper'' This is a 10 amino acides long linker peptide which can be used to join protein domains together in a flexible way. So fusion proteins with variable DNA-binding and activation or repression domains might be assembled. <br\n> false true _253_ 0 3313 9 In stock true To enable the fusion with other domains in frame the vector of this BioBrick has no base pair in between the restriction side and the BioBrick. Furthermore, this coding sequence does not include a start codon.<br\n> For more information about this issus, see:<br\n> Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." <br\n> DSpace http://hdl.handle.net/1721.1/32535 (2006). true Manuel Gersbacher, Katja Karstens BBa_K105012_sequence 1 ggtgaaaatttgtattttcaatctggtggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z