BBa_K105014 1 cln2 cln2 PEST destabilization domain for rapid protein turnover 2008-10-18T11:00:00Z 2015-05-08T01:08:52Z Yeast genomic DNA This BioBrick is the xxx domain of the yeast cln2 protein. It has been shown that this region of part of the protein is suffient to get xxx specific degradation via the APC complex. <br\n> false true _253_ 0 3313 9 It's complicated false To enable the fusion with other domains in frame the vector of this BioBrick has no base pair in between the restriction side and the BioBrick. Furthermore, this coding sequence does not include a start codon.<br\n> For more information about this issus, see:<br\n> Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." <br\n> DSpace http://hdl.handle.net/1721.1/32535 (2006). false Robin Sorg BBa_K105014_sequence 1 gcatccaacttgaacatttcgagaaagcttaccatatcaaccccatcatgctctttcgaaaattcaaatagcacatccattccttcgcccgcttcctcatctcaaagccacactccaatgagaaacatgagctcactctctgataacagcgttttcagccggaatatggaacaatcatcaccaatcactccaagtatgtaccaatttggtcagcagcagtcaaacagtatatgtggtagcaccgttagtgtgaatagtctggtgaatacaaataacaaacaaaggatctacgaacaaatcacgggtcctaacagcaataacgcaaccaatgattatattgatttgctaaacctaaatgagtctaacaaggaaaaccaaaatcccgcaacggcgcattacctcaatgggggcccacccaagacaagcttcattaaccatggaatgttcccctcgccaactgggaccataaatagcggtaaatctagcagtgcctcatctttaatttcttttggtatgggcaatacccaagtaatatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z