BBa_K105015 1 hsl1 hsl1 - cell cycle dependent degradation tag in yeast 2008-10-21T11:00:00Z 2015-05-08T01:08:52Z Yeast genomic DNA This BioBrick is a fragement of the yeast hsl1 protein. Fused to an artificial transcription factor it tiggers the degradation in??? phase via the ???. false false _253_ 0 3313 9 It's complicated true To enable the fusion with the protein in frame the vector of this BioBrick has no base pair in between the restriction sites and the BioBrick. Furthermore, this coding sequence does not include a start codon. For more information about this issus, see: Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." DSpace http://hdl.handle.net/1721.1/32535 (2006). true Robin Sorg BBa_K105015_sequence 1 caaaactcggcttcaaagagatccttatactcattacagtcaatttcaaaacgttccttgaacctgaatgatttattagtctttgacgatcctctccctagtaagaaaccagcatccgaaaatgtgaataaatcagaaccccattcgttggaatcagactctgattttgagatcttatgcgatcagatcttatttggaaacgccttagataggatactcgaagaggaagaggacaatgaaaaagaacgcgacacccaaagacagaggcaaaacgatacaaaatcttcggcagacacttttacgatctctggggtgtctacaaataaggaaaatgagggcccggagtatccaaccaaaattgagaaaaatcaattcaatatgtcatataaaccatctgagaatatgtcagggctctcttcatttcctatctttgaaaaagaaaacacgttaagctcaagttatttggaagaacagaagccaaagagagcggccctttcagatatcacgaactcattcaataaaatgaataaacaggaaggtatgaggatagaaaaaaagattcaaagagaacaacttcaaaaaaaaaatgaccgcccgtcaccactcaaacctattcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z