BBa_K105024 1 BBa_K105024 Gal4 - operator 2008-10-25T11:00:00Z 2015-05-08T01:08:52Z from oligos Released HQ 2013 This BioBrick is the Gal4 recognition site. It can be used for the construction of promoters which should be regulated by activators or repressors containing a Gal4 DNA binding domain ([[Part:BBa_K105007| BBa_K105007]]). <br> <br> false false _253_ 0 3313 9 In stock true This BioBrick contains the consensus sequence plus 5 spacer nucleotides on each side. The spacer is directly followed by the restriction site without a base in between. So when you construct multiple operator sites from this basic part you will have 16 bp between two consensus sequences. true Katja Karstens annotation1989136 1 consensus sequence range1989136 1 6 22 BBa_K105024_sequence 1 tttaccggaggacagtactccgacgta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z