BBa_K105025 1 BBa_K105025 Adh1 terminator 2008-10-25T11:00:00Z 2015-05-08T01:08:52Z yeast genomic DNA This is an aquivalent to [[Part:BBa_J63002| J63002]]. We reconstructed this BioBrick because the length of the part we received from the registery didn't correspond to the J63002. Neither the sequence from the MIT sequencing did. <br\n> false false _253_ 0 3313 9 It's complicated false This BioBrick starts with a stop codon false Katja Karstens BBa_K105025_sequence 1 taataagcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaaattcttattcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagcatgaggtcgctcttattgaccacacctctaccggcatgccgagcaaatgcctgcaaatcgctccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z