BBa_K105029 1 BBa_K105029 cyc43 minimal promoter 2008-10-25T11:00:00Z 2015-05-08T01:08:52Z Amplification and Mutation from the plasmid pAH3 This is a derivate of [[Part:BBa_K105027| BBa_K105027]]. Due to a point mutation in the TATA box region the efficiency of this minimal promoter is only 43 % of the natural yeast CYC1 promoter. <br> <br> false false _253_ 0 3313 9 It's complicated true This BioBrick contains the TATA-box with one point mutation and most of the 5'UTR (-139 to -36, relative to the translational start) of the natural CYC1 promoter. A Kozak sequence is not included and has thus to be added!<br> <br> Even if there isn't any need for this BioBrick to be fusible to other protein domains, we stayed with our design. true Michael Wild annotation1989837 1 TATA-box range1989837 1 17 23 annotation1989838 1 A -> G range1989838 1 23 23 BBa_K105029_sequence 1 gcatgtgctctgtatgtatatagaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z