BBa_K105101 1 BBa_K105101 Gal4 - DNA binding domain 2008-08-11T11:00:00Z 2015-05-08T01:08:53Z plasmid from the local lab containing a Gal4-VP16 chimera This is the DNA binding domain of the Gal4 repressor. Its binding to the operator BBa_K105xxx is no longer dependent on galatose. Our Gal4 - DNA binding domain does not contain neither start nor stop codon. true false _253_ 0 3313 9 Discontinued false To enable the fusion with other domains in frame the vector of this BioBricks has no base pair in between the restriction side and the BioBrick (Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." DSpace http://hdl.handle.net/1721.1/32535 (2006). false Katja Karstens BBa_K105101_sequence 1 aagctactgtcttctatcgaacaagcatgcgatatttgccgacttaaaaagctcaagtgctccaaagaaaaaccgaagtgcgccaagtgtctgaagaacaactgggagtgtcgctactctcccaaaaccaaaaggtctccgctgactagggcacatctgacagaagtggaatcaaggctagaaagactggaacagctatttctactgatttttcctcgagaagaccttgacatgattttgaaaatggattctttacaggatataaaagcattgttaacaggattatttgtacaagataatgtgaataaagatgccgtcacagatagattggcttcagtggagactgatatgcctctaacattgagacagcatagaataagtgcgacatcatcatcggaagagagtagtaacaaaggtcaaagacagttgactgtatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z