BBa_K1051109 1 BBa_K1051109 targeting peptide to mitochondria matrix;MIA40 2013-07-11T11:00:00Z 2015-05-08T01:08:53Z Saccharomyces cerevisiae genomics sequence After added with 23 prefix and suffix, it can be used as a transporter to the mitochondria matrix. Also, when joining with different flourescent proteins, they can light the inner membrane using such proteins. false false _1358_ 0 15923 9 Not in stock false No false Jinchun Zhang BBa_K1051109_sequence 1 atgcttcgcaacttagtcgtcaggaatgcgtgcagaaacaggccgtcaattcaagtggcaagggggttatgccgacaccaaacaagacgtctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z