BBa_K105128 1 BBa_K105128 cyc70 with Kozak 2008-10-29T12:00:00Z 2015-05-08T01:08:54Z BBa_K105028 and BBa_J63003 xxx false false _253_ 0 3313 9 Not in stock false in frame fusion false Katja Karstens annotation1997269 1 A->C range1997269 1 24 24 annotation1997272 1 BBa_K105128 range1997272 1 1 127 annotation1997268 1 TATA-box range1997268 1 17 23 annotation1997271 1 start codon range1997271 1 122 124 annotation1997270 1 BBa_J63003 range1997270 1 110 127 annotation1997267 1 BBa_K105028 range1997267 1 1 103 BBa_K105128_sequence 1 gcatgtgctctgtatgtatataacactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctatactagacccgccgccaccatggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z