BBa_K1051402 1 BBa_K1051402 promoter->gyrB 2013-07-10T11:00:00Z 2015-05-08T01:08:55Z E.coli genome It's a E.coli promoter which initiate the transcription of gene nrdA. nrdA is a protein which have function in segregation of E.coli genome. false false _1358_ 0 15947 9 Not in stock false It's used to initiate the specific FP. false Bingwei Zheng BBa_K1051402_sequence 1 ctctgagcttgatgatgagcgtcgcgggctgcttgccagccgcttaaaagcgacgcaatcacaggtctttgtcagcgcgatcagtgctgaacacgttatagacatgtcggacgaaaattcgaagatgtttaccgtggaaaagggtaaaataacggattaacccaagtataaatgagcgagaaacgttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z