BBa_K1051403 1 BBa_K1051403 promoter->gyrB no RBS 2013-07-10T11:00:00Z 2015-05-08T01:08:55Z E.coli genome It's an E.coli promoter which initiate the transcription of gene nrdA without RBS. nrdA is a protein which have function in segregation of E.coli genome. false false _1358_ 0 15947 9 In stock false It's used to initiate the specific FP. false Bingwei Zheng BBa_K1051403_sequence 1 ctctgagcttgatgatgagcgtcgcgggctgcttgccagccgcttaaaagcgacgcaatcacaggtctttgtcagcgcgatcagtgctgaacacgttatagacatgtcggacgaaaattcgaagatgtttaccgtggaaaagggtaaaataacggatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z