BBa_K1051703 1 BBa_K1051703 SRC1 Intron with additional 6bp at both directions 2013-06-29T11:00:00Z 2015-05-08T01:08:55Z From SRC1 Intron from SRC1 and is added 6bp at both directions. The sequences of the 6bp are identical to the original sequence. false false _1358_ 0 15920 9 It's complicated false no false Yang Zhou BBa_K1051703_sequence 1 atggaggcaagtgagtacaatttattatcttacaaaaattattaaacctgttattatatgataacagttttaattttttttgaatttttttttgtttttgatttatttactaacatcttttcctaattttctctagttatca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z