BBa_K1051704 1 BBa_K1051704 Mer2 Intron 2013-06-29T11:00:00Z 2015-05-08T01:08:55Z From MER2 Intron from MER2. Can be splice into two different forms(spliced or unspliced) by regulating the presence of Mer1. false false _1358_ 0 15920 9 Not in stock false No false Yang Zhou BBa_K1051704_sequence 1 gttcgtaccaacacagtgcataccctcaagttttttattcattttcttccaaaacacatttactaacaactgtagtatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z