BBa_K1053000 1 BBa_K1053000 taRNA responsive Hammerhead Ribozyme(TR-HHR) with RBS 2013-09-09T11:00:00Z 2015-05-08T01:08:55Z the Schistosoma mansoni HHR It's a basic part including only taRNA responsive ribozyme, with the RBS（AAGGAG）. This part is taRNA(taR12) responsive ribozym with RBS (AAGGAG), which can inhibit gene expression responding to binding of taRNA. false false _1360_ 0 17235 9 In stock false An engineered small RNA-mediated genetic switch based on a ribozyme expression platform Benedikt Klauser1 and Jo?? rg S. Hartig Nucleic Acids Research, 2013, Vol. 41 false Ippei Sakamoto BBa_K1053000_sequence 1 ggacgtttagctttctccttcggtacatccagctgatgagtcccaaataggacgaaacctcttggatttgggtattaaagaggtcctggattccacgaaggagatatacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z