BBa_K1053011 1 BBa_K1053011 taRNA(taR42) responsive Hammerhead Ribozyme(TR(42)-HHR) with RBS 2013-09-26T11:00:00Z 2015-05-08T01:08:56Z We introduced some mutations to K1053000 by inverse PCR. It's a basic part including only taRNA responsive ribozyme, with the RBS（AAGGAG）. This part is taRNA(taR42) responsive ribozym with RBS (AAGGAG), which can inhibit gene expression responding to binding of taR42. false false _1360_ 0 17235 9 Not in stock false we introduced some mutations only to taR12 responsive region in K1053000. false Ippei Sakamoto annotation2365789 1 TR(42)-HHR with RBS range2365789 1 14 100 annotation2365786 1 RBS range2365786 1 94 99 annotation2365788 1 complementary to RBS range2365788 1 15 20 annotation2365785 1 taR42 responsive region range2365785 1 55 71 BBa_K1053011_sequence 1 ggacgtttagctttctccttgtacatccagctgatgagtcccaaataggacgaatccgcatcaatttgggtattaatgaggtcctggattccaaaggagatatacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z