BBa_K1053012 1 BBa_K1053012 taRNA(taR12y) responsive Hammerhead Ribozyme(TR(12y)-HHR) with RBS 2013-09-26T11:00:00Z 2015-05-08T01:08:56Z We introduced some mutations only to taR12 responsive region in K1053000. It's a basic part including only taRNA responsive ribozyme, with the RBS（AAGGAG）. This part is taRNA(taR12y) responsive ribozym with RBS (AAGGAG), which can inhibit gene expression responding to binding of taR12y. false false _1360_ 0 17235 9 Not in stock false We introduced some mutations to K1053000 by inverse PCR. false Ippei Sakamoto annotation2365794 1 taR12y responsive region range2365794 1 57 73 annotation2365793 1 TR(12y)-HHR with RBS range2365793 1 14 100 BBa_K1053012_sequence 1 ggacgtttagctttctccttcggtacatccagctgatgagtcccaaataggacgaaacctcttggatttagctattaaagaggtcctggattccacgaaggagatatac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z