BBa_K1053014 1 BBa_K1053014 TR(12)-HHR-taR12y 2013-09-26T11:00:00Z 2015-05-08T01:08:56Z This is composed of BBa_K1053000(taRNA responsive Hammerhead Ribozyme(TR-HHR) with RBS) & BBa_K1053010(PBAD-taR12y-DT) This hammerhead ribozyme(HHR) has trans-acting RNA(taRNA) responsive region, and this HHR responses to taR12. In absence of taR42, the HHR can self-cleave, but in presence of taR12, their capability of self-cleavage is inhibited due to hybridize with taR12 and change their structures. This HHR has taR12y in the downstream. taR12 and taR12y are orthogonal riboregulators reported by Callura et al. false false _1360_ 0 17235 9 Not in stock false The region recognizing TR-HHR in taRNA is sequestrated in HHR's extended stem I. false Ippei Sakamoto annotation2365951 1 taR12y range2365951 1 94 164 annotation2365957 1 TR(12)-HHR range2365957 1 14 100 BBa_K1053014_sequence 1 ggacgtttagctttttgggtgtacatccagctgatgagtcccaaataggacgaaacctcttggatttgggtattaaagaggtcctggattccaagctaaatccaggaggtgattggtagtggtggttaatgaaaattaacttactactaccatatatctctaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z