BBa_K1053121 1 BBa_K1053121 HTLV-1 Rex peptide 2013-09-09T11:00:00Z 2015-05-08T01:08:56Z synthesis The Rex protein of the human T cell leukemia virus type 1 (HTLV-1) belongs to a family of proteins that use arginine-rich motifs (ARMs) to recognize their RNA targets. false false _1360_ 0 16714 9 Not in stock false The Rex protein of the human T cell leukemia virus type 1 (HTLV-1) belongs to a family of proteins that use arginine-rich motifs (ARMs) to recognize their RNA targets. false Yasuhito Ito annotation2360182 1 HTLV-1 Rex peptide range2360182 1 1 54 BBa_K1053121_sequence 1 atgcccaagacccgtcggaggccccgccgatcccaaagaaaaagaccataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z