BBa_K1054002 1 BBa_K1054002 bacteriophage PBSX holin 2013-09-09T11:00:00Z 2015-05-08T01:08:56Z Bacillus subtilis Holin is an essential protein for host lysis by bacteriophage. Its activity can by blocked by another protein called antiholin (BBa_K1054003). We can use this feature to prevent horizontal gene transfer of certain plasmid. false false _1361_ 0 15789 9 It's complicated true No false Jiasheng Wang annotation2338525 1 start range2338525 1 1 3 annotation2338526 1 stop range2338526 1 262 264 BBa_K1054002_sequence 1 atgaacacgtttgacaagggcacggtcatcaggacggtgcttcttttaattgctttaatcaaccagaccatgctgatgctcggcaaatcaccattggacattcaggaggagcaggtcaatcagctcgctgacgctctttattcagccggttccatcgcatttacaattggaacgacacttgccgcttggtttaaaaacaactatgtaacagaaaaagggaaaaaacagcgcgacttgttaagggacaataatctgacgaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z