BBa_K1059003 1 BBa_K1059003 Its transcript can prevent the mRNA itself from being degraded by RNaseE. 2013-09-16T11:00:00Z 2015-05-08T01:08:57Z This segment is design by oueselves. This coding cosists of a RBS ,a start codon and several stop codons in different reading frames. It can be used in the 5'-UTR of a mRNA, preventing the mRNA degradation mediated by RNaseE.The extra RBS can attract ribosome to bind on it.And it has the ability to prevent the degradosome from being actived by 5' ribonucleotide because of it???s steric hindrance.The start codon makes binding more efficient and the stop codon just prevents the DNA???s translation. false false _1367_ 0 15632 9 It's complicated true To make sure the 5' ribonucleotide protected by a ribosome,we must arrange the RBS close to the 5' extreme ribonucleotide.And also ,the "extra RBS " and the "real RBS " must be enough interval, preventing the ribosome interfe with each other. false Qiu Wang annotation2352834 1 start codon range2352834 1 56 58 annotation2352837 1 stop codon range2352837 1 70 72 annotation2352832 1 promoter range2352832 1 1 35 annotation2352835 1 stop codon range2352835 1 59 64 annotation2352833 1 B0035 range2352833 1 43 49 annotation2352836 1 stop codon range2352836 1 66 68 BBa_K1059003_sequence 1 tttacagctagctcagtcctaggtattatgctagcattaaagaggagaagaaagaatgtaataggtgagtagccgtacgataccagcgattatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z