BBa_K1059004 1 BBa_K1059004 Its transcript can prevent the mRNA itself from being degraded by exonuclease. 2013-09-16T11:00:00Z 2015-05-08T01:08:57Z This segment is design by oueselves. This coding cosists of a RBS ,a start codon and several stop codons in different reading frames. It can be used in the 3'-UTR of a mRNA, preventing the mRNA degradation mediated by exonuclease. The extra RBS can attract ribosome to bind on it,which can prevent the mRNA from being degraded by exonuclease . The start codon makes binding more efficient and the stop codon just prevents the DNA???s translation. false false _1367_ 0 15632 9 In stock true The "extra RBS " and the "real RBS " must be enough interval, preventing the ribosome interfe with each other. false Qiu Wang annotation2352984 1 start codon range2352984 1 48 50 annotation2352983 1 B0035 range2352983 1 28 41 annotation2358266 1 stop codon range2358266 1 51 56 BBa_K1059004_sequence 1 cgcttcgcacctaggatctatgctagcattaaagaggagaagaaagaatgtaataggtgagtagccgtacgataccagcgattatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z