BBa_K1059005 1 BBa_K1059005 DNA segment whose transcript can prevent mRNA degradation by RNaseE. 2013-08-28T11:00:00Z 2015-05-08T01:08:57Z This segment is designed by ourselves. This segment consists of two RBS,a start codon and several stop codon in different reading frames. We think it will be higher efficient in protecting mRNA from degradation. It is used in the 5'-UTR of mRNA, preventing mRNA degradation mediated by RNaseE.The extra RBS can binding ribosome, preventing RNaseE or the degradosome actived by 5' ribonucleotide.The start codon is for more efficient binding and the stop codon prevents translation. false false _1367_ 0 15633 9 Not in stock false The "extra RBS " and the "real RBS "there must be enough interval, preventing the ribosome interfereing with each other. false Xue Sun annotation2352897 1 start range2352897 1 163 165 annotation2352896 1 B0035 range2352896 1 120 126 annotation2352894 1 J23101 range2352894 1 1 29 annotation2352895 1 B0035 range2352895 1 43 49 BBa_K1059005_sequence 1 ttacagctagctcagtcctaggtattatgctagcattaaagaggagaagaaagaatgtaataggtgattgtcctgggcatatagaccggctccctcgtctatagagtgcgtattaaagaggagaagaaagaatgtgataagtgagtagccgatgaggggtatacttcgtgagaggagccattaagaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z