BBa_K1059006 1 BBa_K1059006 DNA segment whose transcript can prevent mRNA degradation by RNaseE in two state . 2013-09-16T11:00:00Z 2015-05-08T01:08:57Z This segment is design by oueselves. This coding cosists of a RBS ,a start codon and several stop codons in different reading frames. It can be used in the 5'-UTR of a mRNA, preventing the mRNA degradation mediated by RNaseE.The extra RBS can attract ribosome to bind on it.And it has the ability to prevent the degradosome from being actived by 5' ribonucleotide because of it???s steric hindrance.The start codon makes binding more efficient and the stop codon just prevents the DNA???s translation. false false _1367_ 0 15632 9 Not in stock false To make sure the 5' ribonucleotide protected by a ribosome,we must arrange the RBS close to the 5' extreme ribonucleotide.And also ,the "extra RBS " and the "real RBS " must be enough interval, preventing the ribosome interfe with each other. false Xue Sun annotation2352945 1 start range2352945 1 110 112 annotation2352869 1 RNA thermosensor range2352869 1 100 103 annotation2352870 1 J23101 range2352870 1 1 34 annotation2352946 1 stop range2352946 1 119 121 BBa_K1059006_sequence 1 tttacagctagctcagtcctaggtattatgctagctgtaaaaaacatcatttagcgtgactttctttcaacagctaacaattgttgtaaaaacgattgggggatgagacatgaacgcttaagtgagtagccgatgaggggtatacttcgtgagaggagccagtagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z