BBa_K1059016 1 BBa_K1059016 GFP-LVA under J23101 control 2013-09-16T11:00:00Z 2015-05-08T01:08:57Z The GFP-LVA sequence is from part 145280, but we change the RBS. This device consists of a GFP with LVA tag under the control of J23101 promoter. false false _1367_ 0 15654 9 In stock false The GFP-LVA is from part K145280, but it is reported that the RBS is so weak that it cannot work well, so we have to change the RBS to B0035 by PCR. false Yu Wang annotation2348904 1 BBa_J23101 range2348904 1 1 35 BBa_K1059016_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z