BBa_K106009 1 BBa_K106009 Pif3, Aar1 AB part 2008-10-22T11:00:00Z 2015-05-08T01:08:58Z Arabidopsis thaliana This is a coding sequence for Pif3 gene with BD ends for Aar1 cloning. Binds with PhyB at 720nm light and unbinds at 660nm. false false _226_ 0 3412 9 It's complicated true As a BD part, there is no ATG, and the stop codon is included. For more information on AarI cloning, please refer to the UCSF 2008 igem page. true Willis Wong BBa_K106009_sequence 1 atgcctctgtttgagcttttcaggctcaccaaagctaagcttgaatctgctcaagacaggaacccttctccacctgtagatgaagttgtggagctggtgtgggaaaatggtcagatatcaactcaaagtcagtcaagtagatcgaggaacattcctccaccacaagcaaactcttctagagctagagagattggaaatggctcaaagacgactatggtggacgagatccctatgtcagtgccatcactaatgacgggtttgagtcaagacgatgactttgttccatggttgaatcatcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z