BBa_K1061011 1 BBa_K1061011 EF-1alpha promoter 2013-09-10T11:00:00Z 2015-05-08T01:08:58Z We clone this part from the plasmid provided by Lei Xiao's lab. Ef-1alpha promoter is a strong constitutive promoter that drive the expression of elongation factor -1α.It has been widely used in constructing mammalian cell-based circuit, especially useful for construction of long-term circuit in some cells including iPS cells and Jurkat cells in which the strong promoter CMV may be silenced. false false _1369_ 0 11892 9 In stock false The promoter that we submit comes from the lentivector constructed by Lei Xiao???s lab. It is a truncated version of the full-length human EF-1α promoter, including a cPPT/CTS fragment which can enhance the transduction efficiency of lentivectors. false mengyi sun BBa_K1061011_sequence 1 ttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcgatcacgagactagcctcgacacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagaaatccactttggctcgagaagcttgatatcggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z