BBa_K1061013 1 BBa_K1061013 P tight promoter 2013-09-10T11:00:00Z 2015-05-08T01:08:58Z We get this part from Qu???s lab. It has been constructed and improved by the clontech company, and we standardize them for the use of iGEM teams. It is a response element containing 7 consecutive TetO elements and a minimal CMV promoter. When binding to tTA or rtTA, the expression of the downstream gene will be highly activated. Besides, it can achieve low constitutive expression(almost undectectable) when not binding to tTA or rtTA. false false _1369_ 0 11892 9 In stock false No false mengyi sun BBa_K1061013_sequence 1 cctttcgtcttcattcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z