BBa_K1061011 1 BBa_K1061011 EF-1alpha promoter 2013-09-10T11:00:00Z 2015-05-08T01:08:58Z We clone this part from the plasmid provided by Lei Xiao's lab. Ef-1alpha promoter is a strong constitutive promoter that drive the expression of elongation factor -1α.It has been widely used in constructing mammalian cell-based circuit, especially useful for construction of long-term circuit in some cells including iPS cells and Jurkat cells in which the strong promoter CMV may be silenced. false false _1369_ 0 11892 9 In stock false The promoter that we submit comes from the lentivector constructed by Lei Xiao???s lab. It is a truncated version of the full-length human EF-1α promoter, including a cPPT/CTS fragment which can enhance the transduction efficiency of lentivectors. false mengyi sun BBa_K1061021 1 BBa_K1061021 EF-1alpha-apoptin 2013-09-16T11:00:00Z 2015-05-08T01:08:58Z We got the apoptin from Zhuang's lab,and cloned the EF-1alpha promoter from the plasmid provided by Lei Xiao. This device is a generator that constitutively express apoptin, a protein that can speficially induce apoptosis in cancer cells but not in normal cells. So that it can work like a general safeguard device for the protection of gene therapy. false false _1369_ 0 11892 9 Not in stock false Although it has been try in a broad spectrum of cells and prove to be safe to the normal cells, it still has not been tried in ALL normal cells. So before using it to treat certain kinds of cancer, every team need to ensure that it want hurt the specify normal cells involve in the project. And it is a protein contain 121 amino acid that may big enough to induce immune reaction(although in the experiment of mouse it has not been reported.) false mengyi sun component2348973 1 BBa_K1061011 component2348974 1 BBa_K1061001 annotation2348974 1 BBa_K1061001 range2348974 1 544 909 annotation2348973 1 BBa_K1061011 range2348973 1 1 537 BBa_K1061001 1 BBa_K1061001 apoptin 2013-09-10T11:00:00Z 2015-05-08T01:08:58Z Cloning from plasmid from Zhuang's lab. Apoptin is a protein that is originally isolated from the chicken anemia virus(CAV). It has been found that expressing this gene can induce apoptosis in a broad spectrum of cancer cells but not in normal cells. Hence it is a very powerful tool in treating cancer. Fusion the TAT protein with apoptin can even achieve by-stander effect, and we try to use it in the most simple device of our project. We have successfully expressed it in Hep G2 cell lines and observe a brilliant apoptosis effect. false false _1369_ 0 11892 9 In stock false Although it has been try in a broad spectrum of cells and prove to be safe to the normal cells, it still has not been tried in ALL normal cells. So before using it to treat certain kinds of cancer, every team need to ensure that it want hurt the specify normal cells involve in the project. And it is a protein contain 121 amino acid that may big enough to induce immune reaction(although in the experiment of mouse it has not been reported.) false mengyi sun annotation2362082 1 NLS 1 range2362082 1 244 264 annotation2339023 1 leucine rich fragment range2339023 1 97 138 BBa_K1061001_sequence 1 atgaacgctctccaagaagatactccacccggaccatcaacggtgttcaggccaccaacaagttcacggccgttggaaacccctcactgccgagagatccggattggtatcgctggaattacaatcactctatcgctgtgtggctgcgcgaatgctcgcgctcccacgctaagatctgcaactgcggacaattcagaaagcactggtttcaagaatgtgccggacttgaggaccgatcaacccaagcctccctcgaagaagcgatcctgcgacccctccgagtacagggtaagcgagctaaaagaaagcttgattaccactactcccagccgaccccgaaccgcaaaaaggcgtataagactgtaa BBa_K1061021_sequence 1 ttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcgatcacgagactagcctcgacacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagaaatccactttggctcgagaagcttgatatcggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtactagatgaacgctctccaagaagatactccacccggaccatcaacggtgttcaggccaccaacaagttcacggccgttggaaacccctcactgccgagagatccggattggtatcgctggaattacaatcactctatcgctgtgtggctgcgcgaatgctcgcgctcccacgctaagatctgcaactgcggacaattcagaaagcactggtttcaagaatgtgccggacttgaggaccgatcaacccaagcctccctcgaagaagcgatcctgcgacccctccgagtacagggtaagcgagctaaaagaaagcttgattaccactactcccagccgaccccgaaccgcaaaaaggcgtataagactgtaa BBa_K1061011_sequence 1 ttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcgatcacgagactagcctcgacacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagaaatccactttggctcgagaagcttgatatcggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z