BBa_K1070003 1 BBa_K1070003 pBAD with a mutation 2013-09-08T11:00:00Z 2015-05-08T01:09:00Z part registry For testing the influence of sigma factors' strength and the length between them, we made a gene mutation on pBAD, change one of sigma 70 sequence from gatagt into gataat. false false _1379_ 0 14216 9 Not in stock false false Ruosang Qiu annotation2336759 1 s_mutation range2336759 1 46 47 annotation2336760 1 sigma 70 range2336760 1 21 26 annotation2336761 1 sigma 70 range2336761 1 46 51 BBa_K1070003_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagataatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z