BBa_K1070005 1 BBa_K1070005 pBAD with a mutation 2013-09-08T11:00:00Z 2015-05-08T01:09:00Z Part registry For test the influence of the length between sigma 70, we made a knockout on pBAD, change the sequence from ctttgctatgccatagcaa into ctttggccatagcaa. false false _1379_ 0 14216 9 Not in stock false false Ruosang Qiu annotation2336788 1 mutation range2336788 1 31 32 annotation2336787 1 sigma 70 range2336787 1 46 51 annotation2336785 1 sigma 70 range2336785 1 21 26 BBa_K1070005_sequence 1 acattgattatttgcacggcgtcacactttggccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z