BBa_K1070007 1 BBa_K1070007 pBAD with a mutation 2013-09-08T11:00:00Z 2015-05-08T01:09:00Z Part registry For testing the influence of the length between two sigma 70, we made a knockout on pBAD, change the sequence from ctttgctatgccatagcaa into ctttgctgccatagcaa. false false _1379_ 0 14216 9 Not in stock false false Ruosang Qiu annotation2336817 1 mutation range2336817 1 33 34 annotation2336816 1 sigma 70 range2336816 1 46 51 annotation2336815 1 sigma 70 range2336815 1 21 26 BBa_K1070007_sequence 1 acattgattatttgcacggcgtcacactttgctgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z