BBa_K1072009 1 BBa_K1072009 Bovine rhodopsin signalling pipetide 2013-09-06T11:00:00Z 2015-05-08T01:09:01Z Systhesis BBa_K1072009 is the bovine rhodopsin signalling pipetide with optimized codon. false false _1381_ 0 16002 9 Not in stock false Bovine rhodopsin signalling pipetide guide odr-10 to local S.cerevisiae membrane false Junqi kuang, Xihao liao and Jianhui gong annotation2335361 1 bovine rhodopsin signalling peptide range2335361 1 1 60 BBa_K1072009_sequence 1 atgaatggtactgaaggtcctaacttctatgtccctttctcaaataagactggtgtcgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z