BBa_R0071 1 RhlR+C4 Promoter (RhlR & C4-HSL regulated) 2004-01-24T12:00:00Z 2015-05-08T01:14:15Z <i>Pseudomonas aeruginosa</i> rhlAB promoter Released HQ 2013 Promoter activated by RhlR in concert with C4-HSL. C4-HSL is produced by RhlI, and acts as a quorum-sensing autoinducer. <p> This is the natural sequence taken from Pseudomonas aeruginosa. <p> Crosstalk: this promoter is also activated at a low level by LasR with its associated HSL. false false _1_ 0 24 7 In stock false The -10 and -35 sites are labeled as identified in [Pearson97]. <P> The part begins with the RhlR binding site, and (rather arbitrarily) ends with the first transcribed base (+1). true Ronny Krashinsky annotation297104 1 -10 range297104 1 42 47 annotation297105 1 start range297105 1 53 53 annotation297102 1 RhlR range297102 1 1 20 annotation297103 1 -35 range297103 1 19 24 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_K1073001 1 pRhl + RBS Inducible promoter of the rhl quorum sensing system with RBS 2013-09-15T11:00:00Z 2015-05-08T01:09:01Z Combined construct from BBa_R0071 and BBa_B0032, which were taken from the 2013 distribution kit. This construct is derived from BBa_R0071 and B0032. It combines the rhl induced promoter with an RBS and can be used to clone it in front of a desired gene of interest, which shall be induced by rhl. false false _1382_ 0 15674 9 In stock false no considerations false iGEM Team Braunschweig 2013 component2346211 1 BBa_R0071 component2346213 1 BBa_B0032 annotation2346213 1 BBa_B0032 range2346213 1 62 74 annotation2346211 1 BBa_R0071 range2346211 1 1 53 BBa_K1073011 1 BBa_K1073011 Inducible ampicillin resistance cassette (regulated by RhlR + N-buturyl-HSL) 2013-09-15T11:00:00Z 2015-05-08T01:09:01Z This part is a combination of BBa_K1073001 and BBa_K1073000, which themselves were constructed from biobricks of the 2013 distribution kit. The promoter for this beta-lactonase is induced by N-(butyryl)-homoserine lactone. Therefore the expression of the ampicillin beta-lactonase is inducable by Rhl Inducer N-(butyryl)-homoserine lactone. false false _1382_ 0 15674 9 In stock false no considerations. false iGEM Team Braunschweig 2013 component2373103 1 BBa_K1073000 component2373102 1 BBa_K1073001 annotation2373103 1 BBa_K1073000 range2373103 1 81 944 annotation2373102 1 BBa_K1073001 range2373102 1 1 74 BBa_K1073000 1 ampR ampicillin resistance 2013-09-15T11:00:00Z 2016-01-28T01:50:42Z The part was derived from BBa_P1002 ampicillin resistance cassette. The sequence for the beta-lactamase was gained by PCR of the original BBa_P1002 with appropiate primers. This sequence codes for a beta-lactamase, which degrades ampicillin. There is no RBS or other information attached, only the sequence for the enzyme plus prefix and suffix. false false _1382_ 4206 15674 9 Not in stock false The primer sequences can be found on iGEM Team Braunschweig's wiki. false iGEM Team Braunschweig 2013 BBa_K1073000_sequence 1 atgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgccgaagatcagttgggtgcacgtgtgggttacatcgaactggacctcaacagcggtaagattcttgagagttttcgccccgaagaacgtttcccaatgatgagcacttttaaagttctgctctgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggacggcatgacagtacgcgaattatgcagcgctgccataaccatgagtgataacacggcggccaacttacttctgacaacgatcggaggaccgaaggagcttaccgcttttttgcacaacatgggtgatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagctatggcaacaacgttgcgcaaactcttaactggcgaacttcttactctcgcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtcccgcggtattattgcagccctggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagccaggcaactatggacgaacgtaatcgccagatcgctgagataggtgcctccctgattaagcattggtaataa BBa_K1073001_sequence 1 tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttctactagagtcacacaggaaag BBa_R0071_sequence 1 tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttc BBa_B0032_sequence 1 tcacacaggaaag BBa_K1073011_sequence 1 tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttctactagagtcacacaggaaagtactagatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgccgaagatcagttgggtgcacgtgtgggttacatcgaactggacctcaacagcggtaagattcttgagagttttcgccccgaagaacgtttcccaatgatgagcacttttaaagttctgctctgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggacggcatgacagtacgcgaattatgcagcgctgccataaccatgagtgataacacggcggccaacttacttctgacaacgatcggaggaccgaaggagcttaccgcttttttgcacaacatgggtgatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagctatggcaacaacgttgcgcaaactcttaactggcgaacttcttactctcgcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtcccgcggtattattgcagccctggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagccaggcaactatggacgaacgtaatcgccagatcgctgagataggtgcctccctgattaagcattggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z