BBa_K091117 1 BBa_K091117 pLas promoter 2008-06-25T11:00:00Z 2015-05-08T01:08:37Z The sequence of the LasI upstream regulatory region is available at http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=176640 This pLas' promoter contains the regulatory region upstream of the LasI gene in Pseudomonas aeruginosa. K091117 includes a LasR binding site as well as a -10 region modified from CATAAA to TATAAA to reflect our pLasXOR promoter design. Activation is expected to occur in the presence of the autoinducer PAI-1 and the LasR protein. The pLas' promoter serves as a control for the evaluation of the pLasXOR promoter, part BBa_K091118. false true _191_ 0 3067 9 It's complicated false To minimize leaky transcription, a secondary transcriptional start site was excluded from the design. false Erin Feeney annotation1964072 1 -35 Region range1964072 1 86 91 annotation1964073 1 LasR Binding Site range1964073 1 75 93 annotation1964075 1 Primary Transcriptional Start range1964075 1 125 125 annotation1964074 1 -10 Region range1964074 1 113 118 BBa_K1073013 1 BBa_K1073013 Inducible ampicillin resistance cassette (regulated by LasR + N-3-oxododecanoyl-HSL) 2013-09-15T11:00:00Z 2015-05-08T01:09:01Z This part is a combination of BBa_K1073003 and BBa_K1073000, which themselves were constructed from parts of the 2013 distribution kit. The promoter for this beta-lactonase is induced by N-(3-oxododecanoyl)-homoserine lactone. Therefore the expression of the ampicillin beta-lactonase is inducable by Las inducer N-(3-oxododecanoyl)-homoserine lactone. false false _1382_ 0 15674 9 It's complicated false no considerations. false iGEM Team Braunschweig 2013 component2373123 1 BBa_K1073003 component2373124 1 BBa_K1073000 annotation2373123 1 BBa_K1073003 range2373123 1 1 147 annotation2373124 1 BBa_K1073000 range2373124 1 154 1017 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K1073003 1 pLas + RBS Inducible promoter of the las quorum sensing system with RBS 2013-09-15T11:00:00Z 2015-05-08T01:09:01Z Thos part is a combination of BBa_K091117 and BBa_B0032, which were taken from the 2013 distribution kit. This construct is derived from BBa_K091117 and BBa_B0032. It combines the las induced promoter with an RBS and can be used to clone it in front of a desired gene of interest, which shall be induced by las. false false _1382_ 0 15674 9 It's complicated false no considerations. false iGEM Team Braunschweig 2013 component2346228 1 BBa_K091117 component2346230 1 BBa_B0032 annotation2346228 1 BBa_K091117 range2346228 1 1 126 annotation2346230 1 BBa_B0032 range2346230 1 135 147 BBa_K1073000 1 ampR ampicillin resistance 2013-09-15T11:00:00Z 2016-01-28T01:50:42Z The part was derived from BBa_P1002 ampicillin resistance cassette. The sequence for the beta-lactamase was gained by PCR of the original BBa_P1002 with appropiate primers. This sequence codes for a beta-lactamase, which degrades ampicillin. There is no RBS or other information attached, only the sequence for the enzyme plus prefix and suffix. false false _1382_ 4206 15674 9 Not in stock false The primer sequences can be found on iGEM Team Braunschweig's wiki. false iGEM Team Braunschweig 2013 BBa_K1073000_sequence 1 atgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgccgaagatcagttgggtgcacgtgtgggttacatcgaactggacctcaacagcggtaagattcttgagagttttcgccccgaagaacgtttcccaatgatgagcacttttaaagttctgctctgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggacggcatgacagtacgcgaattatgcagcgctgccataaccatgagtgataacacggcggccaacttacttctgacaacgatcggaggaccgaaggagcttaccgcttttttgcacaacatgggtgatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagctatggcaacaacgttgcgcaaactcttaactggcgaacttcttactctcgcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtcccgcggtattattgcagccctggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagccaggcaactatggacgaacgtaatcgccagatcgctgagataggtgcctccctgattaagcattggtaataa BBa_K1073013_sequence 1 tgttctcgtgtgaagccattgctctgatcttttggacgtttcttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagttataaaattatgaaatttgtataaattcttcagtactagagtcacacaggaaagtactagatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgccgaagatcagttgggtgcacgtgtgggttacatcgaactggacctcaacagcggtaagattcttgagagttttcgccccgaagaacgtttcccaatgatgagcacttttaaagttctgctctgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggacggcatgacagtacgcgaattatgcagcgctgccataaccatgagtgataacacggcggccaacttacttctgacaacgatcggaggaccgaaggagcttaccgcttttttgcacaacatgggtgatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagctatggcaacaacgttgcgcaaactcttaactggcgaacttcttactctcgcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtcccgcggtattattgcagccctggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagccaggcaactatggacgaacgtaatcgccagatcgctgagataggtgcctccctgattaagcattggtaataa BBa_K091117_sequence 1 tgttctcgtgtgaagccattgctctgatcttttggacgtttcttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagttataaaattatgaaatttgtataaattcttcag BBa_B0032_sequence 1 tcacacaggaaag BBa_K1073003_sequence 1 tgttctcgtgtgaagccattgctctgatcttttggacgtttcttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagttataaaattatgaaatttgtataaattcttcagtactagagtcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z