BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_C0078 1 lasI autoinducer synthetase for PAI from Pseudomonas aeruginosa 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z www.ncbi.nlm.nih.gov Released HQ 2013 coding region for lasI protein, which produces the chemical signal AI-1 false false _1_ 0 24 7 In stock false true Chris Walsh (Fighting Darwins) annotation306608 1 LVA range306608 1 604 636 annotation305970 1 LasI range305970 1 1 603 annotation2214003 1 Help:Barcodes range2214003 1 643 667 BBa_K1073018 1 BBa_K1073018 Autoinducer synthetase LasI ( producing N-3-oxododecanoyl-HSL) with RBS and double terminator 2013-09-16T11:00:00Z 2015-05-08T01:09:01Z The part is a combination of BBa_B0032, BBa_C0078, and BBa_B0015, which were taken from the 2013 distribution kit. To the lasI protein, which produces the chemical signal AI-1, a RBS and a double terminator was added to facilitate the construction of an expression system. false false _1382_ 0 15674 9 In stock false no considerations. false iGEM Team Braunschweig 2013 component2354053 1 BBa_B0032 component2354058 1 BBa_C0078 component2354065 1 BBa_B0015 annotation2354058 1 BBa_C0078 range2354058 1 20 686 annotation2354053 1 BBa_B0032 range2354053 1 1 13 annotation2354065 1 BBa_B0015 range2354065 1 695 823 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0078_sequence 1 atgatcgttcagatcggtcgtcgtgaagagttcgacaaaaaactgctgggtgaaatgcacaaactgcgtgctcaggttttcaaagaacgtaaaggttgggacgtttccgttatcgacgaaatggaaatcgacggttacgacgctctgtccccgtactacatgctgatccaggaagacaccccggaagctcaggttttcggttgctggcgtatcttcgacaccaccggtccgtacatgctgaaaaacaccttcccggaactgctgcacggtaaagaagctccgtgctccccgcacatctgggaactgtcccgtttcgctatcaactccggtcagaaaggttccctgggtttctccgactgcaccctggaagctatgcgtgctctggctcgttactccttgcagaacgacatccagaccctggttaccgttaccaccgttggtgttgaaaaaatgatgatccgtgctggtctggacgtttcccgtttcggtccgcacctgaaaatcggtatcgaacgtgctgttgctctgcgtatcgaactgaacgctaaaacccagatcgctctgtacggtggtgttctggttgaacagcgtctggctgtttccgctgctaacgacgaaaactacgctctggttgcttaataactctgatagtgctagtgtagatctc BBa_B0032_sequence 1 tcacacaggaaag BBa_K1073018_sequence 1 tcacacaggaaagtactagatgatcgttcagatcggtcgtcgtgaagagttcgacaaaaaactgctgggtgaaatgcacaaactgcgtgctcaggttttcaaagaacgtaaaggttgggacgtttccgttatcgacgaaatggaaatcgacggttacgacgctctgtccccgtactacatgctgatccaggaagacaccccggaagctcaggttttcggttgctggcgtatcttcgacaccaccggtccgtacatgctgaaaaacaccttcccggaactgctgcacggtaaagaagctccgtgctccccgcacatctgggaactgtcccgtttcgctatcaactccggtcagaaaggttccctgggtttctccgactgcaccctggaagctatgcgtgctctggctcgttactccttgcagaacgacatccagaccctggttaccgttaccaccgttggtgttgaaaaaatgatgatccgtgctggtctggacgtttcccgtttcggtccgcacctgaaaatcggtatcgaacgtgctgttgctctgcgtatcgaactgaacgctaaaacccagatcgctctgtacggtggtgttctggttgaacagcgtctggctgtttccgctgctaacgacgaaaactacgctctggttgcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z