BBa_K592010 1 amilGFP amilGFP, yellow chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora This chromoprotein, amilGFP, naturally exhibits very strong yellow color when expressed. The color is strong and readily visible to naked eye both in LB-culture and on agar plates. The DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of two illegal internal restriction sites (EcoRI and PstI). false false _763_ 0 7929 9 It's complicated false Two illegal internal restriction sites (EcoRI and PstI) was removed. false Lei Sun annotation2131633 1 amilGFP range2131633 1 1 696 BBa_K1073024 1 BBa_K1073024 Constitutively expressed chromoprotein amilGFP 2013-09-16T11:00:00Z 2015-05-08T01:09:01Z This part is a combination of BBa_K1073006 and BBa_K592010, which were derived from the 2013 distribution kit and the iGEM Team Uppsala. The chromoprotein amilGFP is constitutively expressed and can be used for the marking of cells for easier differentiation. false false _1382_ 0 15674 9 In stock false no considerations. false iGEM Team Braunschweig 2013 component2354084 1 BBa_K1073006 component2354086 1 BBa_K592010 annotation2354086 1 BBa_K592010 range2354086 1 63 761 annotation2354084 1 BBa_K1073006 range2354084 1 1 56 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1073006 1 BBa_K1073006 strong constitutive promoter with RBS 2013-09-15T11:00:00Z 2015-05-08T01:09:01Z This part is a combination of BBa_J23106 and BBa_B0032, which were taken from 2013 distribution kit. This part combines a constitutive promoter with an RBS and can be cloned in front of a gene of interest. It is a combination of BBa_J23106 and BBa_B0032. false false _1382_ 0 15674 9 In stock false no considerations. false iGEM Team Braunschweig 2013 component2352908 1 BBa_J23100 component2352910 1 BBa_B0032 annotation2352908 1 BBa_J23100 range2352908 1 1 35 annotation2352910 1 BBa_B0032 range2352910 1 44 56 BBa_K1073006_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagtcacacaggaaag BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1073024_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagtcacacaggaaagtactagatgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaatggccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatcatcaagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttcacaaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttctatttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatctttcatggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaaatgactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatgccaatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtgaggaccgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttgaaggttaaataataa BBa_B0032_sequence 1 tcacacaggaaag BBa_K592010_sequence 1 atgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaatggccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatcatcaagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttcacaaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttctatttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatctttcatggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaaatgactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatgccaatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtgaggaccgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttgaaggttaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z