BBa_K1074000 1 BBa_K1074000 TD1, Transdermal peptide 2013-09-08T11:00:00Z 2015-05-08T01:09:02Z synthetic TD1 is a short synthetic peptide(ACSSSPSKHCG)identified by in vivo phage display, facilitated efficient transdermal protein delivery through intact skin. false false _1383_ 0 16001 9 It's complicated true The transdermal-enhancing activity of the peptide was sequence specific. false Changlong Zhao BBa_K1074000_sequence 1 gcttgttcttcttccccatctaagcattgtggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z