BBa_K1074004 1 BBa_K1074004 Protective Antigen Domain 4 2013-09-11T11:00:00Z 2015-05-08T01:09:02Z From the plasmid pXOI of B.anthrax Protective antigen (PA) is the central component of the three-part protein toxin secreted by Bacillus anthracis, the organism responsible for anthrax. Homologues of PA have been found in several spore-forming Gram-positive bacteria, and share the ability to translocate toxic enzymes into the host cytosol.The PA monomer is organised mainly into antiparallel beta-sheets and has four domains: an N-terminal domain (domain 1) containing two calcium ions and the cleavage site for activating proteases; a heptamerisation domain (domain 2) containing a large flexible loop implicated in membrane insertion; a small domain of unknown function (domain 3); and a carboxy-terminal receptor-binding domain (domain 4) [PMID: 9039918]. This entry represents domain 4 of PA, which has an immunoglobulin-like fold. Domain 4 plays a key role in cellular receptor recognition, as well as in pH-dependent pore formation[PMID: 19722284]. false false _1383_ 0 16001 9 Not in stock false NO false Changlong Zhao BBa_K1074004_sequence 1 tttcattatgatagaaataacatagcagttggggctgatgagtcagtagttaaggaggctcatagagaagtaattaattcgtcaacagagggattattgttaaatattgataaggatataagaaaaatattatcaggttatattgtagaaattgaagatactgaagggcttaaagaagttataaatgacagatatgatatgttgaatatttctagtttacggcaagatggaaaaacatttatagattttaaaaaatataatgataaattaccgttatatataagtaatcccaattataaggtaaatgtatatgctgttactaaagaaaacactattattaatcctagtgagaatggggatactagtaccaacgggatcaagaaaattttaatcttttctaaaaaaggctatgagataggataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z