BBa_K1074014 1 BBa_K1074014 SamyQ 2013-09-16T11:00:00Z 2015-05-08T01:09:02Z From recombinant plasmid PHT43. SamyQ is the signal peptide of the amyQ gene encoding an α-amylase in Bacillus subtilis WB800N. Fuse it with the recombinant proteins to obtain the secretion of recombinant proteins in Bacillus subtilis. false false _1383_ 0 16001 9 Not in stock false NO false Changlong Zhao BBa_K1074014_sequence 1 atgattcaaaaacgaaagcggacagtttcgttcagacttgtgcttatgtgcacgctgttatttgtcagtttgccgattacaaaaacatcagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z