BBa_K1075009 1 BBa_K1075009 E. coli sspB[XB] 2013-09-21T11:00:00Z 2015-05-08T01:09:02Z PCR amplification of full length E. coli sspB. Originally E. Coli sspB is found in the genome of E. coli. EcsspB itself regulates the degradation of ssrA tagged proteins through the ClpXP protease in procaryotes. In engineered systems it is used to induce degradation of specifically ssrA tagged proteins. This construct is part of the split system of E. Coli sspB (EcsspB) which was used in fusion with FKBP and FRB to induce the activity of sspB and therefore degradation of proteins with Rapamycins. [1] EcsspB can be functionally divided in three parts: [2] -the N terminal Core domain (113 AA) -the C terminal XB peptide (25 AA) -and a 'flexible linker' in between the first parts (28 AA) We used the same domain structure as is used within the Rapamycin inducable split system. [1] While the Core domain is responsible for dimerization of sspB and binding of ssrA the XB peptide binds the protease ClpXP. The flexible linker is called flexible because it was found, that an increase or reduction in size or amino acid composition does not influence the function of sspB as much as it would in the other domains. [3] For our project we needed the sspB split system to engineer a light inducable sspB. false false _1384_ 0 12108 9 In stock false We used the same length of the XB peptide than used for the Rapamycin inducable split system. [1] false Max Schelski BBa_K1075009_sequence 1 gacactcatcctgacgatgaacctccgcagccaccacgcggtggtcgaccggcattacgcgttgtgaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z