BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1075014 1 BBa_K1075014 RBS32-VinD1-sspB[XB]-TT 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z a a false false _1384_ 0 16105 9 It's complicated false a false Marc Schulte component2358790 1 BBa_B0032 component2358800 1 BBa_B0015 component2358793 1 BBa_K1075009 component2358792 1 BBa_K1075011 annotation2358790 1 BBa_B0032 range2358790 1 1 13 annotation2358800 1 BBa_B0015 range2358800 1 885 1013 annotation2358793 1 BBa_K1075009 range2358793 1 802 876 annotation2358792 1 BBa_K1075011 range2358792 1 20 793 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 BBa_K1075009 1 BBa_K1075009 E. coli sspB[XB] 2013-09-21T11:00:00Z 2015-05-08T01:09:02Z PCR amplification of full length E. coli sspB. Originally E. Coli sspB is found in the genome of E. coli. EcsspB itself regulates the degradation of ssrA tagged proteins through the ClpXP protease in procaryotes. In engineered systems it is used to induce degradation of specifically ssrA tagged proteins. This construct is part of the split system of E. Coli sspB (EcsspB) which was used in fusion with FKBP and FRB to induce the activity of sspB and therefore degradation of proteins with Rapamycins. [1] EcsspB can be functionally divided in three parts: [2] -the N terminal Core domain (113 AA) -the C terminal XB peptide (25 AA) -and a 'flexible linker' in between the first parts (28 AA) We used the same domain structure as is used within the Rapamycin inducable split system. [1] While the Core domain is responsible for dimerization of sspB and binding of ssrA the XB peptide binds the protease ClpXP. The flexible linker is called flexible because it was found, that an increase or reduction in size or amino acid composition does not influence the function of sspB as much as it would in the other domains. [3] For our project we needed the sspB split system to engineer a light inducable sspB. false false _1384_ 0 12108 9 In stock false We used the same length of the XB peptide than used for the Rapamycin inducable split system. [1] false Max Schelski BBa_K1075011 1 BBa_K1075011 Vinculin D1 2013-09-21T11:00:00Z 2015-05-08T01:09:02Z It was PCR amplified from a plasmid containing full length Vinculin from M. musculus. This is the D1 Domain of mammalian Vinculin. It forms a tight Dimer with the ipaA peptide. false false _1384_ 0 12108 9 It's complicated false We used the same amino acid sequence as used for the light inducible heterodimerisation system from Lungu et al. [1] false Max Schelski BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1075011_sequence 1 atgccggtgtttcacacgcgtacgatcgagagcatcctggagccggtggcgcagcagatctcgcacctggtgattatgcacgaggagggcgaggtggacggcaaagccattcctgacctcaccgcgcccgtagccgccgtgcaggcggccgtcagcaacctcgtccgggttggaaaagagactgttcagaccactgaggatcagattctgaagagagatatgccaccagcctttattaaggttgaaaatgcttgcaccaagcttgttcaggcagcccagatgcttcagtcagacccatactcggttcctgcgcgggattacctcattgacggctctaggggaatcctttctggcacatctgacctactgcttacctttgatgaggctgaggttcgtaaaattattagggtttgcaaaggaattttggaatatcttacagtggcagaggtagtggaaactatggaagacttggtcacttacacaaagaatcttgggccaggaatgactaagatggccaaaatgattgatgagagacagcaggagttgactcaccaggaacaccgtgtgatgttggtgaactcaatgaacactgtcaaagagctgcttcctgttctcatttcagctatgaagatttttgttacaaccaaaaactcaaaaaaccaaggaatagaagaagctttgaaaaatcgaaattttactgtagaaaagatgagtgctgaaattaacgagatcattcgtgtgttacaactcacttcctgggatgaagacgcctgg BBa_B0032_sequence 1 tcacacaggaaag BBa_K1075009_sequence 1 gacactcatcctgacgatgaacctccgcagccaccacgcggtggtcgaccggcattacgcgttgtgaagtaataa BBa_K1075014_sequence 1 tcacacaggaaagtactagatgccggtgtttcacacgcgtacgatcgagagcatcctggagccggtggcgcagcagatctcgcacctggtgattatgcacgaggagggcgaggtggacggcaaagccattcctgacctcaccgcgcccgtagccgccgtgcaggcggccgtcagcaacctcgtccgggttggaaaagagactgttcagaccactgaggatcagattctgaagagagatatgccaccagcctttattaaggttgaaaatgcttgcaccaagcttgttcaggcagcccagatgcttcagtcagacccatactcggttcctgcgcgggattacctcattgacggctctaggggaatcctttctggcacatctgacctactgcttacctttgatgaggctgaggttcgtaaaattattagggtttgcaaaggaattttggaatatcttacagtggcagaggtagtggaaactatggaagacttggtcacttacacaaagaatcttgggccaggaatgactaagatggccaaaatgattgatgagagacagcaggagttgactcaccaggaacaccgtgtgatgttggtgaactcaatgaacactgtcaaagagctgcttcctgttctcatttcagctatgaagatttttgttacaaccaaaaactcaaaaaaccaaggaatagaagaagctttgaaaaatcgaaattttactgtagaaaagatgagtgctgaaattaacgagatcattcgtgtgttacaactcacttcctgggatgaagacgcctggtactagaggacactcatcctgacgatgaacctccgcagccaccacgcggtggtcgaccggcattacgcgttgtgaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z