BBa_J23105 1 BBa_J23105 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K1075018 1 BBa_K1075018 J23105-RBS32-SspB[Core]-LOV-ipaA-TT 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z a a false false _1384_ 0 16105 9 Not in stock false a false Marc Schulte component2368765 1 BBa_J23105 component2368778 1 BBa_K1075017 annotation2368765 1 BBa_J23105 range2368765 1 1 35 annotation2368778 1 BBa_K1075017 range2368778 1 44 1039 BBa_K1075017 1 BBa_K1075017 RBS32-sspB[Core]-LOV-ipaA-TT 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z a a false false _1384_ 0 16105 9 It's complicated false a false Marc Schulte component2368732 1 BBa_B0032 component2368734 1 BBa_K1075008 component2368735 1 BBa_K1075012 component2368742 1 BBa_B0015 annotation2368742 1 BBa_B0015 range2368742 1 868 996 annotation2368734 1 BBa_K1075008 range2368734 1 20 358 annotation2368732 1 BBa_B0032 range2368732 1 1 13 annotation2368735 1 BBa_K1075012 range2368735 1 365 859 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K1075008 1 BBa_K1075008 E. coli sspB[Core] 2013-09-21T11:00:00Z 2015-05-08T01:09:02Z PCR amplification of full length E. coli sspB. Originally E. Coli sspB is found in the genome of E. coli. EcsspB itself regulates the degradation of ssrA tagged proteins through the ClpXP protease in procaryotes. In engineered systems it is used to induce degradation of specifically ssrA tagged proteins. This construct is part of the split system of E. Coli sspB (EcsspB) which was used in fusion with FKBP and FRB to induce the activity of sspB and therefore degradation of proteins with Rapamycins. [1] EcsspB can be functionally divided in three parts: [2] -the N terminal Core domain (113 AA) -the C terminal XB peptide (25 AA) -and a 'flexible linker' in between the first parts (28 AA) We used the same domain structure as is used within the Rapamycin inducable split system. [1] While the Core domain is responsible for dimerization of sspB and binding of ssrA the XB peptide binds the protease ClpXP. The flexible linker is called flexible because it was found, that an increase or reduction in size or amino acid composition does not influence the function of sspB as much as it would in the other domains. [3] For our project we needed the sspB split system to engineer a light inducable sspB. false false _1384_ 0 12108 9 It's complicated false We used the same length of the XB peptide than used for the Rapamycin inducable split system. [1] false Max Schelski BBa_K1075012 1 BBa_K1075012 AsLOV2-ipaA 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z it was amplified from a plasmid from Addgene - provided by Klaus Hahn. LOV2 originally comes from Avena sativa while the ipaA peptide comes from Shigella spp. Fusion of LOV 2 (A. sativa) with the ipaA peptide. It forms light inducable a tight dimer with Vinculin. [1] false false _1384_ 0 12108 9 Not in stock false the fusion protein was designed by Lungu et al. [1] false Max Schelski BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1075017_sequence 1 tcacacaggaaagtactagatggatttgtcacagctaacaccacgtcgtccctatctgctgcgtgcattctatgagtggttgctggataaccagctcacgccgcacctggtggtggatgtgacgctccctggcgtgcaggttcctatggaatatgcgcgtgacgggcaaatcgtactcaacattgcgccgcgtgctgtcggcaatctggaactggcgaatgatgaggtgcgctttaacgcgcgctttggtggcattccgcgtcaggtttctgtgccgctggctgccgtgctggctatctacgcccgtgaaaatggcgcaggcacgatgttcgaacctgaagctgcctacgatgaagattactagatgcatcatcatcatcatcatggcagcctggcgaccaccctggaacgtattgaaaagaactttgtgattaccgatccgcgtctgccggataacccgattatttttgcgagcgatagctttctgcaactgaccgaatatagccgtgaagaaattctgggccgtaactgccgttttctgcaaggcccggaaaccgatcgtgcgaccgtgcgtaaaattcgtgatgcgattgataaccagaccgaagtgaccgtgcagctgattaactataccaaaagcggcaaaaaattttggaacctgtttcatctgcaaccgatgcgtgatcagaaaggcgatgtgcagtattttattggcgtgcagaaggatggtaccgaacatgtgcgtgatgcggcggaacgtgaaggcgtgatggaaatcaagaaaaccgcgaacaacattattaaagcggcgaaagatgtgaccaccagcctgagcaaagtgctgaaaaacattaactaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1075018_sequence 1 tttacggctagctcagtcctaggtactatgctagctactagagtcacacaggaaagtactagatggatttgtcacagctaacaccacgtcgtccctatctgctgcgtgcattctatgagtggttgctggataaccagctcacgccgcacctggtggtggatgtgacgctccctggcgtgcaggttcctatggaatatgcgcgtgacgggcaaatcgtactcaacattgcgccgcgtgctgtcggcaatctggaactggcgaatgatgaggtgcgctttaacgcgcgctttggtggcattccgcgtcaggtttctgtgccgctggctgccgtgctggctatctacgcccgtgaaaatggcgcaggcacgatgttcgaacctgaagctgcctacgatgaagattactagatgcatcatcatcatcatcatggcagcctggcgaccaccctggaacgtattgaaaagaactttgtgattaccgatccgcgtctgccggataacccgattatttttgcgagcgatagctttctgcaactgaccgaatatagccgtgaagaaattctgggccgtaactgccgttttctgcaaggcccggaaaccgatcgtgcgaccgtgcgtaaaattcgtgatgcgattgataaccagaccgaagtgaccgtgcagctgattaactataccaaaagcggcaaaaaattttggaacctgtttcatctgcaaccgatgcgtgatcagaaaggcgatgtgcagtattttattggcgtgcagaaggatggtaccgaacatgtgcgtgatgcggcggaacgtgaaggcgtgatggaaatcaagaaaaccgcgaacaacattattaaagcggcgaaagatgtgaccaccagcctgagcaaagtgctgaaaaacattaactaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23105_sequence 1 tttacggctagctcagtcctaggtactatgctagc BBa_B0032_sequence 1 tcacacaggaaag BBa_K1075008_sequence 1 atggatttgtcacagctaacaccacgtcgtccctatctgctgcgtgcattctatgagtggttgctggataaccagctcacgccgcacctggtggtggatgtgacgctccctggcgtgcaggttcctatggaatatgcgcgtgacgggcaaatcgtactcaacattgcgccgcgtgctgtcggcaatctggaactggcgaatgatgaggtgcgctttaacgcgcgctttggtggcattccgcgtcaggtttctgtgccgctggctgccgtgctggctatctacgcccgtgaaaatggcgcaggcacgatgttcgaacctgaagctgcctacgatgaagat BBa_K1075012_sequence 1 atgcatcatcatcatcatcatggcagcctggcgaccaccctggaacgtattgaaaagaactttgtgattaccgatccgcgtctgccggataacccgattatttttgcgagcgatagctttctgcaactgaccgaatatagccgtgaagaaattctgggccgtaactgccgttttctgcaaggcccggaaaccgatcgtgcgaccgtgcgtaaaattcgtgatgcgattgataaccagaccgaagtgaccgtgcagctgattaactataccaaaagcggcaaaaaattttggaacctgtttcatctgcaaccgatgcgtgatcagaaaggcgatgtgcagtattttattggcgtgcagaaggatggtaccgaacatgtgcgtgatgcggcggaacgtgaaggcgtgatggaaatcaagaaaaccgcgaacaacattattaaagcggcgaaagatgtgaccaccagcctgagcaaagtgctgaaaaacattaactaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z