BBa_K1075032 1 BBa_K1075032 ccdA - Antitoxin in ccdA/ccdB system 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z it was synthezised by Integrated DNA technologies ccdA binds the toxin ccdB and represses cell death. false false _1384_ 0 12108 9 It's complicated false sequence was taken from ncbi false Max Schelski BBa_K1075032_sequence 1 atgaagcagcgcattacagtcaccgtcgacagtgacagctatcagttgctcaaggcatatgatgtcaatatctccggtctggtaagcaccaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcagaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgccgatgagaacagggactggtgaaatgcagtttaaggtttacaccta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z