BBa_K1075020 1 ssrA(DAS+4 E. coli ssrA(DAS+4) 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z PCR amplification from gene synthesis fused to the C terminus of a protein it triggers degradation upon induction of sspB function. false false _1384_ 0 12108 9 Not in stock false we used the E. coli ssrA tag with a weakened interaction with ClpXP and a linker of 4 amino acids in between to optimize degradation speed increase upon induction with sspB. [1] false Max Schelski BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K1075033 1 BBa_K1075033 RBS32-ccdA-ssrA 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z a a false false _1384_ 0 16105 9 It's complicated false a false Marc Schulte component2358538 1 BBa_B0032 component2358540 1 BBa_K1075020 annotation2358540 1 BBa_K1075020 range2358540 1 22 72 annotation2358538 1 BBa_B0032 range2358538 1 1 13 BBa_K1075020_sequence 1 gcagctaacgatgaaaactacagcgaaaactatgctgacgctagctaataa BBa_B0032_sequence 1 tcacacaggaaag BBa_K1075033_sequence 1 tcacacaggaaagtactagaggcagctaacgatgaaaactacagcgaaaactatgctgacgctagctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z