BBa_K1075020 1 ssrA(DAS+4 E. coli ssrA(DAS+4) 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z PCR amplification from gene synthesis fused to the C terminus of a protein it triggers degradation upon induction of sspB function. false false _1384_ 0 12108 9 Not in stock false we used the E. coli ssrA tag with a weakened interaction with ClpXP and a linker of 4 amino acids in between to optimize degradation speed increase upon induction with sspB. [1] false Max Schelski BBa_K1075034 1 BBa_K1075034 RBS32-ccdA-ssrA-TT 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z a a false false _1384_ 0 16105 9 It's complicated false a false Marc Schulte component2358552 1 BBa_K1075033 component2358547 1 BBa_B0015 annotation2358547 1 BBa_B0015 range2358547 1 1 129 annotation2358552 1 BBa_K1075033 range2358552 1 138 209 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1075033 1 BBa_K1075033 RBS32-ccdA-ssrA 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z a a false false _1384_ 0 16105 9 It's complicated false a false Marc Schulte component2358538 1 BBa_B0032 component2358540 1 BBa_K1075020 annotation2358540 1 BBa_K1075020 range2358540 1 22 72 annotation2358538 1 BBa_B0032 range2358538 1 1 13 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1075034_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtcacacaggaaagtactagaggcagctaacgatgaaaactacagcgaaaactatgctgacgctagctaataa BBa_K1075020_sequence 1 gcagctaacgatgaaaactacagcgaaaactatgctgacgctagctaataa BBa_B0032_sequence 1 tcacacaggaaag BBa_K1075033_sequence 1 tcacacaggaaagtactagaggcagctaacgatgaaaactacagcgaaaactatgctgacgctagctaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z