BBa_K1076000 1 BBa_K1076000 fatty acid metabolism regulator protein FadR 2013-09-12T11:00:00Z 2015-05-08T01:09:03Z It comes from amplified genomic sequence This is a fatty acid metabolic regulator gene from FadR protein from Shewanella putrefaciens. It regulates membrane fluidity by manipulating the relative levels of saturated and unsaturated fatty acids within the phospholipids of their membrane bilayers. The transcription factor, FadR, functions as a switch that co-ordinately regulates the machinery required for fatty acid beta-oxidation and the expression of a key enzyme in fatty acid biosynthesis. FadR is specifically inhibited by long chain fatty acyl-CoA compounds. false false _1385_ 0 13948 9 It's complicated false It was design taking in consideration we had to put in a conjugative plasmid (pNPTS138) in E. coli and further on trasform Shewanella putrefaciens by conjugation. To put into pNPTS138 we used primers with Apa1(5') and BamH1(3')ends. After in order to put into pSB1C3 we clonned it in Topo plasmids and cut with Xba1 and Spe1 to further ligation on pSB1C3. false Luna Lacerda, Adolfo Mota, Carlos Gustavo Nunes BBa_K1076000_sequence 1 ggccgggccctccaccagggtccattttaccggctgaacgtgagctttccgagttgatcggtgtcacccgcaccactctacgtgaagtgcttcaacgcttagcccgtgatggctggttgaaaattcaacatggaaaaccaacacgagtcaataatttttgggaaacgtcggggcttaatattcttgagacgattgccgatcttaatcctgaaggttttcccgtattagttgaccaactgctatctgcaagaacgaatgtcagcgcgatctatttccgtggtgctttgcgttataatccagaaacagcggtcgacgtgttagctaaaattcaccaactagaaaataccgcagaatcttttgctgagtatgactatttattgcatcacacgttagcgttttcatcaggaaatcctctttacgttttgattttaaatggctttaaaggattatatagccgagttggtcgttattactttagcagcgctgaagcgcgattattggcattaaacttctataaagagttagaagtgctcgcggatccgatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z