BBa_K1077001 1 fimIRR fim switch inverted repeat right IRR natural 2013-09-15T11:00:00Z 2015-05-08T01:09:03Z Synthesized based on E. coli CFT073 genomic sequence fim switch inverted repeat right IRR natural. Ligate a part upstream, then ligate the IRL upstream of that. This switch half is in the "ON" orientation. false false _1386_ 0 13249 9 It's complicated true This switch half is in the "ON" orientation. false Mike Ferguson and Joshua Abramson BBa_K1077001_sequence 1 gatatagacagtttggccccaaatgtttcatcttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z